graphpad prims 8.3.0 Search Results


caco-2  (ATCC)
99
ATCC caco-2
Caco 2, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caco-2/product/ATCC
Average 99 stars, based on 1 article reviews
caco-2 - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
d6007 highprep pcr clean up system magbiogenomics  (Zymo Research)
95
Zymo Research d6007 highprep pcr clean up system magbiogenomics
KEY RESOURCES TABLE
D6007 Highprep Pcr Clean Up System Magbiogenomics, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/d6007 highprep pcr clean up system magbiogenomics/product/Zymo Research
Average 95 stars, based on 1 article reviews
d6007 highprep pcr clean up system magbiogenomics - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier
prim 8.3.0 (538  (GraphPad Software Inc)
90
GraphPad Software Inc prim 8.3.0 (538
KEY RESOURCES TABLE
Prim 8.3.0 (538, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prim 8.3.0 (538/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prim 8.3.0 (538 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
graphpad prime  (GraphPad Software Inc)
90
GraphPad Software Inc graphpad prime
KEY RESOURCES TABLE
Graphpad Prime, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prime/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prime - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
graphpad prims 8.3.0  (GraphPad Software Inc)
90
GraphPad Software Inc graphpad prims 8.3.0
KEY RESOURCES TABLE
Graphpad Prims 8.3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prims 8.3.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prims 8.3.0 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
2017 n a serum  (ATCC)
96
ATCC 2017 n a serum
KEY RESOURCES TABLE
2017 N A Serum, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2017 n a serum/product/ATCC
Average 96 stars, based on 1 article reviews
2017 n a serum - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
resource source identifier antibodies alkaline phosphatase affinipure goat anti mouse igg h l jackson immuno research  (Jackson Immuno)
95
Jackson Immuno resource source identifier antibodies alkaline phosphatase affinipure goat anti mouse igg h l jackson immuno research
KEY RESOURCES TABLE
Resource Source Identifier Antibodies Alkaline Phosphatase Affinipure Goat Anti Mouse Igg H L Jackson Immuno Research, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/resource source identifier antibodies alkaline phosphatase affinipure goat anti mouse igg h l jackson immuno research/product/Jackson Immuno
Average 95 stars, based on 1 article reviews
resource source identifier antibodies alkaline phosphatase affinipure goat anti mouse igg h l jackson immuno research - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell host & microbe

Article Title: Fungal trans-kingdom dynamics linked to responsiveness to fecal microbiota transplantation (FMT) therapy in ulcerative colitis

doi: 10.1016/j.chom.2020.03.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alkaline Phosphatase AffiniPure Goat Anti-Mouse IgG (H+L) Jackson Immuno Research Cat # 115-055-146 Bacterial and fungal Strains Candida albicans SC5314 ATCC MYA-2876 Biological samples Fecal samples from donor and UC FMT and placebo recipient Paramsothy et al., 2017 N/A Serum samples from UC FMT and placebo recipient Paramsothy et al., 2017 N/A Chemicals, Peptides, and Recombinant Proteins Fetal Bovine Serum Corning Cat# MT35016CV Lyticase from Arthrobacter luteus Sigma Cat# L2524 PNPP (p-nitrophenyl phosphate) Sigma Cat# 34045 Sabouraud dextrose broth VWR Cat# 89406-400 Critical Commercial Assays Quick-DNA Fungal/Bacterial Kit Zymo Research Cat# D6007 HighPrep™ PCR Clean-up System Magbiogenomics Cat# AC-60050 Kapa BiosystemsSupplier Diversity Partner HIFI HOTSTART READYMIX 500RXN Fisher Scientific Cat# KK2602 Nextera XT Index Kit v2 kit A Nextera XT Index Kit v2 Set B Illumina Cat# FC-131-200, FC-131-2002 QIAEX II Gel Extraction Kit Qiagen Cat# 20021 AccuPrime™ Taq DNA Polymerase, high fidelity Thermofisher Cat# 12346086 Oligonucleotides ITS1F: CTTGGTCATTTAGAGGAAGTAA, Li et al., 2018 N/A ITS2R: GCTGCGTTCTTCATCGATGC Li et al., 2018 NA Nextera Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific sequence] Illumina N/A Nextera Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence] Illumina NA Deposited Data 16S sequencing Paramsothy et al., 2017 European Nucleotide Archive, https://www.ebi.ac.uk/ena : PRJEB26472, PRJEB26474, PRJEB26473, PRJEB20349 and PRJEB26357 ITS Sequencing This paper NCBI BioProject repository, https://www.ncbi.nlm.nih.gov/bioproject/ : PRJNA590898 Software and Algorithms GraphPad Prim 8.3.0 (538) GraphPad Software N/A RStudio Desktop 1.2.1335 R Studio https://rstudio.com/ QIIME v1.6 QIIME www.qiime.org R version 3.5.0 (2018-04-23) R www.r-project.org Phyloseq v1.26.1 Phyloseq https://bioconductor.org/packages/release/bioc/html/phyloseq.html Vegan v2.5-5 Vegan https://cran.r-project.org/web/packages/vegan/ Estimation Stats DabestR v0.2.2 Ho et al, 2019 https://github.com/ACCLAB/dabestr Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Gel Extraction, Sequencing, Software

KEY RESOURCES TABLE

Journal: Cell host & microbe

Article Title: Fungal trans-kingdom dynamics linked to responsiveness to fecal microbiota transplantation (FMT) therapy in ulcerative colitis

doi: 10.1016/j.chom.2020.03.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alkaline Phosphatase AffiniPure Goat Anti-Mouse IgG (H+L) Jackson Immuno Research Cat # 115-055-146 Bacterial and fungal Strains Candida albicans SC5314 ATCC MYA-2876 Biological samples Fecal samples from donor and UC FMT and placebo recipient Paramsothy et al., 2017 N/A Serum samples from UC FMT and placebo recipient Paramsothy et al., 2017 N/A Chemicals, Peptides, and Recombinant Proteins Fetal Bovine Serum Corning Cat# MT35016CV Lyticase from Arthrobacter luteus Sigma Cat# L2524 PNPP (p-nitrophenyl phosphate) Sigma Cat# 34045 Sabouraud dextrose broth VWR Cat# 89406-400 Critical Commercial Assays Quick-DNA Fungal/Bacterial Kit Zymo Research Cat# D6007 HighPrep™ PCR Clean-up System Magbiogenomics Cat# AC-60050 Kapa BiosystemsSupplier Diversity Partner HIFI HOTSTART READYMIX 500RXN Fisher Scientific Cat# KK2602 Nextera XT Index Kit v2 kit A Nextera XT Index Kit v2 Set B Illumina Cat# FC-131-200, FC-131-2002 QIAEX II Gel Extraction Kit Qiagen Cat# 20021 AccuPrime™ Taq DNA Polymerase, high fidelity Thermofisher Cat# 12346086 Oligonucleotides ITS1F: CTTGGTCATTTAGAGGAAGTAA, Li et al., 2018 N/A ITS2R: GCTGCGTTCTTCATCGATGC Li et al., 2018 NA Nextera Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific sequence] Illumina N/A Nextera Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence] Illumina NA Deposited Data 16S sequencing Paramsothy et al., 2017 European Nucleotide Archive, https://www.ebi.ac.uk/ena : PRJEB26472, PRJEB26474, PRJEB26473, PRJEB20349 and PRJEB26357 ITS Sequencing This paper NCBI BioProject repository, https://www.ncbi.nlm.nih.gov/bioproject/ : PRJNA590898 Software and Algorithms GraphPad Prim 8.3.0 (538) GraphPad Software N/A RStudio Desktop 1.2.1335 R Studio https://rstudio.com/ QIIME v1.6 QIIME www.qiime.org R version 3.5.0 (2018-04-23) R www.r-project.org Phyloseq v1.26.1 Phyloseq https://bioconductor.org/packages/release/bioc/html/phyloseq.html Vegan v2.5-5 Vegan https://cran.r-project.org/web/packages/vegan/ Estimation Stats DabestR v0.2.2 Ho et al, 2019 https://github.com/ACCLAB/dabestr Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Gel Extraction, Sequencing, Software